levR [2019-07-08 09:08:03]

transcriptional activator of the levD-levE-levF-levG-sacC operon

Locus: BSU27080

Isoelectric point: 5.94

Molecular weight: 105.99 kDa

Protein length: 935 aa

Gene length: 2808 bp

Function: regulation of levan and fructose utilization

Product: transcriptional activator, PRD-type (for SigL-dependent promoter)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of other polymeric carbohydrates
• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of fructose
• Information processing → Regulation of gene expression → Transcription factors and their control → PRD-type regulators
• Groups of genes → Phosphoproteins → Phosphorylation on a His residue

Gene

Coordinates: 2,763,025 2,765,832

The protein

Catalyzed reaction/ biological activity

• binding to the upstream activating sequence in front of the levD gene results in activation of transcription of the levD-levE-levF-levG-sacC operon, bining occurs in the presence of fructose

Protein family

• Transcription factors activating transcription at SigL-dependent promoters
• PRD-containing transcription factors

Modification

• phosphorylation (His503, His582, His866) (according to Swiss-Prot)

Localization

• cytoplasm (according to Swiss-Prot)

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: levR
  Description: PubMed

Biological materials

Mutant

• BKE27080 (levR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACGTCTATCATCCTTTGTC, downstream forward: _UP4_TAAAAACAGTTTTTTCATAT
• BKK27080 (levR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACGTCTATCATCCTTTGTC, downstream forward: _UP4_TAAAAACAGTTTTTTCATAT

References

Loading